DNA transcription

Useful to know: strings.

DNA (deoxyribonucleic acid) is the molecule that carries the genetic information of all known living organisms (life on exoplanets might be totally different!). The genetic information is stored as a sequence of nucleotides of which there are four: adenine (A), cytosine (C), guanine (G), and thymine (T). So a DNA sequence can be stored on a computer as a string of ATCG characters.


Certain DNA sequences contain the information required to syntheize proteins, and the first step in the process is to transcribe the DNA sequence into a ribonucleic acid (RNA) sequence. The transcription process is biochemically complex, however the resulting RNA sequence is simple: it's equal to the DNA sequence with all instances of T replaced with a U (uracil).


Given the DNA string as input, return the transcribed RNA string. Keep in mind that these sequences can be very long (the human genome is 3,088,286,401 characters or base pairs long!).

Comparison of DNA and RNA with their corresponding nucleotides. (Wikimedia Commons / CC BY-SA 3.0)


Input: A string of ATCG characters representing a DNA sequence.


Output: The RNA sequence corresponding to the input DNA sequence.


Example input

CCAGGACCAGGCCCCAGGTGGGGCCAGGCCAGGCTC

Example output

CCAGGACCAGGCCCCAGGUGGGGCCAGGCCAGGCUC

You must be logged in to submit code but you can play around with the editor.


You must be logged in to upload code.

  • Lots of pretty cool genes like Sonic Hedgehog (Shh).